Need the old site? GenomicsDB v. 2.1

1:207692049:A:G (rs6656401)

TTTCCTTCTCTGTCTCCATCTTCTC[A/G]TCGCCTTCTCCTCTGTGTGTGTCCT

single-nucleotide variant

This position (chr1:207692049) coincides with additional variants:

More information

NOTE: Corresponding records for this variant may not exist in the ExAC or GTex resources.

Genomic Context

The genome browser snapshot is fully interactive. Mouse over track elements for more information. Click and drag to move tracks. Click and drag on top positional guide to zoom to a sub-region.

To add tracks, use the provided link to switch to the full genome browser view.

This variant falls within the gene: CR1.

Full Browser View

Population Frequencies
INFO TBA

Population Ethnicity Resource Allele Frequency
GAF Global 1000 Genomes Phase 1 G 0.933
AFR African 1000 Genomes Phase 3 G 0.994
AMR Ad Mixed American 1000 Genomes Phase 3 G 0.921
EAS East Asian 1000 Genomes Phase 3 G 0.964
EUR European 1000 Genomes Phase 3 G 0.826
GAF Global 1000 Genomes Phase 3 G 0.933
SAS South Asian 1000 Genomes Phase 3 G 0.939

Trait Associations (GWAS)

NIAGADS: Alzheimer's Disease

NIAGADS AD GWAS summary statistics datasets in which this variant has a genome-wide significance supported by a p-value ≤ 5 x 10-8.

For exome array studies, a cutoff of p-value < 1 x 10-3 was used.

Click on accession numbers to view a detailed report about the dataset or to request access to the data.

To view functional genomics annotations on the genome browser, first select tracks in the table below and then use the provided button to load the tracks on the browser.

Allele p-Value Track Accession
A 5.7e-24
IGAP 2013: Stages 1 and 2
NG00036
A 7.7e-15
IGAP 2013: Stage 1
NG00036
A 3.4e-10
ADGC 2011: Stages 1 and 2
NG00027
A 1.9e-8
ADGC 2011: Stage 1
NG00027
A 3.3e-8
ADGC 2011: Adjusted Stages 1 and 2
NG00027

NHGRI GWAS Catalog: Alzheimer's Disease

Alzheimer's Disease-related annotations for the dbSNP refSNP associated with this variant in the NHGRI GWAS Catalog.

Allele Gene Frequency p-Value Odds Ratio/Beta Trait EFO Study Design Study
A CR1 0.197 6.0e-24 1.18 Alzheimers disease EFO_0000249 8,572 European ancestry cases, 11,312 European ancestry controls Meta-analysis of 74,046 individuals identifies 11 new susceptibility loci for Alzheimer's disease. PMID: 24162737

NIAGADS: Related neuropathologies and AD biomarkers

NIAGADS AD GWAS summary statistics datasets in which this variant has a genome-wide significance supported by a p-value ≤ 5 x 10-8.

For exome array studies, a cutoff of p-value < 1 x 10-3 was used.

Click on accession numbers to view a detailed report about the dataset or to request access to the data.

NHGRI: Other Traits (incl. related neuropathologies and AD biomarkers)

Trait associations for the dbSNP refSNP associated with this variant in the NHGRI GWAS Catalog.

Predicted Variant Effect

This variant is colocated with 11 transcripts in 1 gene, with the following predicted effects:

All Predictd Variant Effects (incl. intergenic)

Most Severe Predicted Variant Effect

Group By: Analysis Consequence Impact Gene

Analysis Gene Transcripts Consequence Impact
SnpEff CR1 all transcripts intron variant MODIFIER
SnpEff AL691452.1 all transcripts downstream gene variant MODIFIER

Functional Genomics

Transcription Factor Binding Site Overlap (ENCODE ChIP-SEQ)

DNase Hotspots Overlap (ENCODE DNase-SEQ)

Expressed Enhancer Overlap (FANTOM5)