19:45411941:T:C (rs429358)
GCTGGGCGCGGACATGGAGGACGTGC/TGCGGCCGCCTGGTGCAGTACCGCGG
single-nucleotide variant
WGS Filter Status: PASS: present in both, passed in GATK, failed in ATLAS
WES Filter Status: PASS: pass in both GATK and ATLAS
NOTE: Corresponding records for this variant may not exist in the ExAC or GTex resources.
Genomic Context
The genome browser snapshot is fully interactive. Mouse over track elements for more information. Click and drag to move tracks. Click and drag on top positional guide to zoom to a sub-region.
To add tracks, use the provided link to switch to the full genome browser view.
The genome browser snapshot is fully interactive. Mouse over track elements for more information. Click and drag to move tracks. Click and drag on top positional guide to zoom to a sub-region.
To add tracks, use the provided link to switch to the full genome browser view.
This variant falls within the gene: APOE.
Full Browser View
Population Frequencies
Alternative/minor allele frequencies reported by various studies or from standard resources (1000 Genomes, dbSNP, ExAC) for specific populations.
When the population is identified as Global, it typically refers to a meta-value calculated across all populations in the study or resource; mouse over for more information.
Frequencies are reported as documented in the orignial data source or calculated as a ratio of observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present.
Data sources are listed in the documentation.
The 1000Genomes Phase 1 frequencies were obtained from dbSNP.
Alternative/minor allele frequencies reported by various studies or from standard resources (1000 Genomes, dbSNP, ExAC) for specific populations.
When the population is identified as Global, it typically refers to a meta-value calculated across all populations in the study or resource; mouse over for more information.
Frequencies are reported as documented in the orignial data source or calculated as a ratio of observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present.
Data sources are listed in the documentation.
The 1000Genomes Phase 1 frequencies were obtained from dbSNP.
| Population | Ethnicity | Resource | Allele | Frequency |
|---|---|---|---|---|
| GAF | Global | 1000 Genomes Phase 1 | C | 0.151 |
| AFR | African | 1000 Genomes Phase 3 | C | 0.268 |
| AMR | Ad Mixed American | 1000 Genomes Phase 3 | C | 0.104 |
| EAS | East Asian | 1000 Genomes Phase 3 | C | 0.086 |
| EUR | European | 1000 Genomes Phase 3 | C | 0.155 |
| GAF | Global | 1000 Genomes Phase 3 | C | 0.151 |
| SAS | South Asian | 1000 Genomes Phase 3 | C | 0.087 |
| Adj | Global | ExAC | C | 0.184 |
| AFR | African/African American | ExAC | C | 0.273 |
| AMR | Ad Mixed American | ExAC | C | 0.215 |
| EAS | East Asian | ExAC | C | 0.150 |
| FIN | Finnish | ExAC | C | 0.327 |
| NFE | Non-Finnish European | ExAC | C | 0.208 |
| OTH | Other ethnicity | ExAC | C | 0.171 |
| SAS | South Asian | ExAC | C | 0.110 |
| KGAF | Global | Kaviar | C | 0.099 |
Variant-based Trait Associations (GWAS)
The following variants have been found to be associated with Alzheimer's disease in a GWAS study:
NIAGADS: Alzheimer's Disease
NIAGADS AD GWAS summary statistics datasets in which this variant has a genome-wide significance supported by a p-value ≤ 5 x 10-8.
For exome array studies, a cutoff of p-value < 1 x 10-3 was used.
Click on accession numbers to view a detailed report about the dataset or to request access to the data.
NIAGADS AD GWAS summary statistics datasets in which this variant has a genome-wide significance supported by a p-value ≤ 5 x 10-8.
For exome array studies, a cutoff of p-value < 1 x 10-3 was used.
Click on accession numbers to view a detailed report about the dataset or to request access to the data.
To view functional genomics annotations on the genome browser, first select tracks in the table below and then use the provided button to load the tracks on the browser.
| Allele | p-Value | Track | Accession |
|---|---|---|---|
| T | 1.4e-546 |
Transethnic LOAD: All Samples
|
NG00056 |
| C | 6.7e-536 |
IGAP 2013: Stage 1
|
NG00036 |
| T | 6.6e-357 |
IGAP (2013): ADGC Subset
|
NG00053 |
| T | 8.1e-89 |
ADGC Age of Onset LOAD
|
NG00048 |
| T | 5.5e-47 |
ADGC African Americans 2013
|
NG00039 |
| T | 3.3e-8 |
Transethnic LOAD: APOE e4 Non-Carriers
|
NG00056 |
NHGRI GWAS Catalog: Alzheimer's Disease
Alzheimer's Disease-related annotations for the dbSNP refSNP associated with this variant in the NHGRI GWAS Catalog.
Alzheimer's Disease-related annotations for the dbSNP refSNP associated with this variant in the NHGRI GWAS Catalog.
| Allele | Gene | Frequency | p-Value | Odds Ratio/Beta | Trait | EFO | Study Design | Study |
|---|---|---|---|---|---|---|---|---|
| ? | APOE | 0.442 | 4.0e-17 | 0.4 | Alzheimers disease | EFO_0000249 | 515 individuals | SUCLG2 identified as both a determinator of CSF Au00df1-42-levels and an attenuator of cognitive decline in Alzheimer's disease. PMID: 25027320 |
| C | APOE | 0.280 | 5.0e-14 | N/A | Alzheimers disease | EFO_0000249 | N/A | APOE and BCHE as modulators of cerebral amyloid deposition: a florbetapir PET genome-wide association study. PMID: 23419831 |
| ? | APOE | N/A | 1.0e-6 | N/A | Alzheimers disease | EFO_0000249 | N/A | Genome-wide association study of CSF biomarkers Abeta1-42, t-tau, and p-tau181p in the ADNI cohort. PMID: 21123754 |
The following variants have been associated with AD-relevant neuropathologies in a GWAS study:
NIAGADS: Related neuropathologies and AD biomarkers
NIAGADS AD GWAS summary statistics datasets in which this variant has a genome-wide significance supported by a p-value ≤ 5 x 10-8.
For exome array studies, a cutoff of p-value < 1 x 10-3 was used.
Click on accession numbers to view a detailed report about the dataset or to request access to the data.
NIAGADS AD GWAS summary statistics datasets in which this variant has a genome-wide significance supported by a p-value ≤ 5 x 10-8.
For exome array studies, a cutoff of p-value < 1 x 10-3 was used.
Click on accession numbers to view a detailed report about the dataset or to request access to the data.
NHGRI: Other Traits (incl. related neuropathologies and AD biomarkers)
Trait associations for the dbSNP refSNP associated with this variant in the NHGRI GWAS Catalog.
Trait associations for the dbSNP refSNP associated with this variant in the NHGRI GWAS Catalog.
Predicted Variant Effect
Combined Annotation Dependent Depletion (CADD) PHRED-normalized scores.
The higher the score, the more deleterious the substitution is predicted to be.
PHRED-normalized scores indicate ranked deleteriousness across ~8.6 billion SNVs on the human genome (GRCh37/hg19).
A normalized-score ≥10 indicates that the variant is predicted to be among the 10% most deleterious substitutions on the human genome.
A score ≥20 indicates that the variant is among the top 1% most deleterious.
The ranked deleteriousness of this variant (CADD PHRED-score) is: 10.11
This variant is colocated with 4 transcripts in 1 gene, with the following predicted effects:
and click each search that needs revision.