View on GenomicsDBv4 beta site   

19:45411941:T:C (rs429358)

GCTGGGCGCGGACATGGAGGACGTGC/TGCGGCCGCCTGGTGCAGTACCGCGG

single-nucleotide variant

ADSP Variant WES WGS

WGS Filter Status: PASS: present in both, passed in GATK, failed in ATLAS

WES Filter Status: PASS: pass in both GATK and ATLAS

More information

NOTE: Corresponding records for this variant may not exist in the ExAC or GTex resources.

Contents

Genomic Context

The genome browser snapshot is fully interactive. Mouse over track elements for more information. Click and drag to move tracks. Click and drag on top positional guide to zoom to a sub-region.

To add tracks, use the provided link to switch to the full genome browser view.

This variant falls within the gene: APOE.

Full Browser View

Population Frequencies

Alternative/minor allele frequencies reported by various studies or from standard resources (1000 Genomes, dbSNP, ExAC) for specific populations.

When the population is identified as Global, it typically refers to a meta-value calculated across all populations in the study or resource; mouse over for more information.

Frequencies are reported as documented in the orignial data source or calculated as a ratio of observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present.

Data sources are listed in the documentation.

The 1000Genomes Phase 1 frequencies were obtained from dbSNP.

Back to Top
Population Ethnicity Resource Allele Frequency
GAF Global 1000 Genomes Phase 1 C 0.151
AFR African 1000 Genomes Phase 3 C 0.268
AMR Ad Mixed American 1000 Genomes Phase 3 C 0.104
EAS East Asian 1000 Genomes Phase 3 C 0.086
EUR European 1000 Genomes Phase 3 C 0.155
GAF Global 1000 Genomes Phase 3 C 0.151
SAS South Asian 1000 Genomes Phase 3 C 0.087
Adj Global ExAC C 0.184
AFR African/African American ExAC C 0.273
AMR Ad Mixed American ExAC C 0.215
EAS East Asian ExAC C 0.150
FIN Finnish ExAC C 0.327
NFE Non-Finnish European ExAC C 0.208
OTH Other ethnicity ExAC C 0.171
SAS South Asian ExAC C 0.110
KGAF Global Kaviar C 0.099

Variant-based Trait Associations (GWAS)

Back to Top

The following variants have been found to be associated with Alzheimer's disease in a GWAS study:

NIAGADS: Alzheimer's Disease

NIAGADS AD GWAS summary statistics datasets in which this variant has a genome-wide significance supported by a p-value ≤ 5 x 10-8.

For exome array studies, a cutoff of p-value < 1 x 10-3 was used.

Click on accession numbers to view a detailed report about the dataset or to request access to the data.

Back to Top

To view functional genomics annotations on the genome browser, first select tracks in the table below and then use the provided button to load the tracks on the browser.

Allele p-Value Track Accession
T 1.4e-546
Transethnic LOAD: All Samples
NG00056
C 6.7e-536
IGAP 2013: Stage 1
NG00036
T 6.6e-357
IGAP (2013): ADGC Subset
NG00053
T 4.3e-131
AD Age of Onset Survival (IGAP)
NG00058
T 8.1e-89
ADGC Age of Onset LOAD
NG00048
T 5.5e-47
ADGC African Americans 2013
NG00039
T 3.3e-8
Transethnic LOAD: APOE e4 Non-Carriers
NG00056

NHGRI GWAS Catalog: Alzheimer's Disease

Alzheimer's Disease-related annotations for the dbSNP refSNP associated with this variant in the NHGRI GWAS Catalog.

Back to Top
Allele Gene Frequency p-Value Odds Ratio/Beta Trait EFO Study Design Study
? APOE 0.442 4.0e-17 0.4 Alzheimers disease EFO_0000249 515 individuals SUCLG2 identified as both a determinator of CSF Au00df1-42-levels and an attenuator of cognitive decline in Alzheimer's disease. PMID: 25027320
C APOE 0.280 5.0e-14 N/A Alzheimers disease EFO_0000249 N/A APOE and BCHE as modulators of cerebral amyloid deposition: a florbetapir PET genome-wide association study. PMID: 23419831
? APOE N/A 1.0e-6 N/A Alzheimers disease EFO_0000249 N/A Genome-wide association study of CSF biomarkers Abeta1-42, t-tau, and p-tau181p in the ADNI cohort. PMID: 21123754

The following variants have been associated with AD-relevant neuropathologies in a GWAS study:

NIAGADS: Related neuropathologies and AD biomarkers

NIAGADS AD GWAS summary statistics datasets in which this variant has a genome-wide significance supported by a p-value ≤ 5 x 10-8.

For exome array studies, a cutoff of p-value < 1 x 10-3 was used.

Click on accession numbers to view a detailed report about the dataset or to request access to the data.

NHGRI: Other Traits (incl. related neuropathologies and AD biomarkers)

Trait associations for the dbSNP refSNP associated with this variant in the NHGRI GWAS Catalog.

Predicted Variant Effect

Back to Top

Combined Annotation Dependent Depletion (CADD) PHRED-normalized scores.

The higher the score, the more deleterious the substitution is predicted to be.

PHRED-normalized scores indicate ranked deleteriousness across ~8.6 billion SNVs on the human genome (GRCh37/hg19).

A normalized-score ≥10 indicates that the variant is predicted to be among the 10% most deleterious substitutions on the human genome.

A score ≥20 indicates that the variant is among the top 1% most deleterious.

The ranked deleteriousness of this variant (CADD PHRED-score) is: 10.11

This variant is colocated with 4 transcripts in 1 gene, with the following predicted effects:

All Predictd Effects (incl. intergenic)

Most Severe Predicted Effects

Back to Top

Group By: Analysis Consequence Impact Gene

Analysis Gene Ranked Over Consequence Impact
SnpEff TOMM40 all transcripts downstream gene variant MODIFIER
SnpEff APOE all transcripts missense variant MODERATE

Functional Genomics

Back to Top

Transcription Factor Occupancy (CATO)
contextual analysis of transcription factor occupancy (CATO) scores precomputed for dbSNP 142 in humans (hg19)

Transcription Factor Binding Site Overlap (ENCODE ChIP-SEQ)

DNase Hotspots Overlap (ENCODE DNase-SEQ)

Expressed Enhancer Overlap (FANTOM5)