19:45411941:T:C (rs429358)

GCTGGGCGCGGACATGGAGGACGTG[C/T]GCGGCCGCCTGGTGCAGTACCGCGG

single-nucleotide variant

More information

NOTE: Corresponding records for this variant may not exist in the ExAC or GTex resources.

Genomic Context

The genome browser snapshot is fully interactive. Mouse over track elements for more information. Click and drag to move tracks. Click and drag on top positional guide to zoom to a sub-region.

To add tracks, use the provided link to switch to the full genome browser view.

This variant falls within the gene: APOE.

Full Browser View

Contents

Back to top

Population Frequencies
INFO TBA

Population Ethnicity Resource Allele Frequency
GAF Global 1000 Genomes Phase 1 C 0.151
AFR African 1000 Genomes Phase 3 C 0.268
AMR Ad Mixed American 1000 Genomes Phase 3 C 0.104
EAS East Asian 1000 Genomes Phase 3 C 0.086
EUR European 1000 Genomes Phase 3 C 0.155
GAF Global 1000 Genomes Phase 3 C 0.151
SAS South Asian 1000 Genomes Phase 3 C 0.087
AFR African/African American ExAC ADSP C 0.273
AMR Latino ExAC ADSP C 0.215
EAS East Asian ExAC ADSP C 0.150
ExGADJ Global ExAC ADSP C 0.184
FIN Finnish ExAC ADSP C 0.327
NFE Non-Finnish European ExAC ADSP C 0.208
OTH Other ethnicity ExAC ADSP C 0.171
SAS South Asian ExAC ADSP C 0.110
KGAF Global Kaviar ADSP C 0.099

Trait Associations (GWAS)

NIAGADS: Alzheimer's Disease

NIAGADS AD GWAS summary statistics datasets in which this variant has a genome-wide significance supported by a p-value ≤ 5 x 10-8.

For exome array studies, a cutoff of p-value < 1 x 10-3 was used.

Click on accession numbers to view a detailed report about the dataset or to request access to the data.

To view functional genomics annotations on the genome browser, first select tracks in the table below and then use the provided button to load the tracks on the browser.

Allele p-Value Track Accession
T 1.4e-546
Transethnic LOAD: All Samples
NG00056
C 6.7e-536
IGAP 2013: Stage 1
NG00036
T 6.6e-357
IGAP (2013): ADGC Subset
NG00053
T 8.1e-89
ADGC Age of Onset LOAD
NG00048
T 5.5e-47
ADGC African Americans 2013
NG00039
T 3.3e-8
Transethnic LOAD: APOE e4 Non-Carriers
NG00056

NHGRI GWAS Catalog: Alzheimer's Disease

Alzheimer's Disease-related annotations for the dbSNP refSNP associated with this variant in the NHGRI GWAS Catalog.

Allele Gene Frequency p-Value Odds Ratio/Beta Trait EFO Study Design Study
? APOE 0.442 4.0e-17 0.4 Alzheimers disease EFO_0000249 515 individuals SUCLG2 identified as both a determinator of CSF Au00df1-42-levels and an attenuator of cognitive decline in Alzheimer's disease. PMID: 25027320
C APOE 0.280 5.0e-14 N/A Alzheimers disease EFO_0000249 N/A APOE and BCHE as modulators of cerebral amyloid deposition: a florbetapir PET genome-wide association study. PMID: 23419831
? APOE N/A 1.0e-6 N/A Alzheimers disease EFO_0000249 N/A Genome-wide association study of CSF biomarkers Abeta1-42, t-tau, and p-tau181p in the ADNI cohort. PMID: 21123754

NIAGADS: Related neuropathologies and AD biomarkers

NIAGADS AD GWAS summary statistics datasets in which this variant has a genome-wide significance supported by a p-value ≤ 5 x 10-8.

For exome array studies, a cutoff of p-value < 1 x 10-3 was used.

Click on accession numbers to view a detailed report about the dataset or to request access to the data.

NHGRI: Other Traits (incl. related neuropathologies and AD biomarkers)

Trait associations for the dbSNP refSNP associated with this variant in the NHGRI GWAS Catalog.

Predicted Variant Effect

This variant is colocated with 4 transcripts in 1 gene, with the following predicted effects:

All Predictd Effects (incl. intergenic)

Most Severe Predicted Effects

Group By: Analysis Consequence Impact Gene

Analysis Gene Ranked Over Consequence Impact
SnpEff APOE all transcripts missense variant MODERATE
SnpEff TOMM40 all transcripts downstream gene variant MODIFIER

Functional Genomics

Transcription Factor Binding Site Overlap (ENCODE ChIP-SEQ)

DNase Hotspots Overlap (ENCODE DNase-SEQ)

Expressed Enhancer Overlap (FANTOM5)