The NIAGADS Alzheimer's GenomicsDB will be down for maintenance from 8pm Saturday August 7, 2021 - Sunday August 8, 2021. We apologize for the inconvenience.

View on GenomicsDBv4 beta site   

19:1043864:G:C (rs4622634)

AGGTGTGCGGGGGTGCTGGGGAGGTA/C/GGGATGTGGCTCCCCGGTGAGGAGGG

single-nucleotide variant

This variant is multi-allelic

ADSP Variant WGS

WGS Filter Status: PASS: pass in both GATK and ATLAS

WES Filter Status: FAIL: failed in both GATK and ATLAS

More information

NOTE: Corresponding records for this variant may not exist in the ExAC or GTex resources.

Genomic Context

The genome browser snapshot is fully interactive. Mouse over track elements for more information. Click and drag to move tracks. Click and drag on top positional guide to zoom to a sub-region.

To add tracks, use the provided link to switch to the full genome browser view.

This variant falls within the gene: ABCA7.

Full Browser View

Population Frequencies

Alternative/minor allele frequencies reported by various studies or from standard resources (1000 Genomes, dbSNP, ExAC) for specific populations.

When the population is identified as Global, it typically refers to a meta-value calculated across all populations in the study or resource; mouse over for more information.

Frequencies are reported as documented in the orignial data source or calculated as a ratio of observed-to-total, where the numerator (observed samples) is the number of chromosomes in the study with the minor allele present.

Data sources are listed in the documentation.

The 1000Genomes Phase 1 frequencies were obtained from dbSNP.

Back to Top
Population Ethnicity Resource Allele Frequency
GAF Global 1000 Genomes Phase 1 C 0.359
AFR African 1000 Genomes Phase 3 C 0.157
AMR Ad Mixed American 1000 Genomes Phase 3 C 0.608
EAS East Asian 1000 Genomes Phase 3 C 0.425
EUR European 1000 Genomes Phase 3 C 0.380
GAF Global 1000 Genomes Phase 3 C 0.359
SAS South Asian 1000 Genomes Phase 3 C 0.364
Adj Global ExAC C 0.430
AFR African/African American ExAC C 0.209
AMR Ad Mixed American ExAC C 0.717
EAS East Asian ExAC C 0.425
FIN Finnish ExAC C 0.407
NFE Non-Finnish European ExAC C 0.421
OTH Other ethnicity ExAC C 0.443
SAS South Asian ExAC C 0.412

Variant-based Trait Associations (GWAS)

Back to Top

The following variants have been found to be associated with Alzheimer's disease in a GWAS study:

NIAGADS: Alzheimer's Disease

NIAGADS AD GWAS summary statistics datasets in which this variant has a genome-wide significance supported by a p-value ≤ 5 x 10-8.

For exome array studies, a cutoff of p-value < 1 x 10-3 was used.

Click on accession numbers to view a detailed report about the dataset or to request access to the data.

Back to Top

To view functional genomics annotations on the genome browser, first select tracks in the table below and then use the provided button to load the tracks on the browser.

Allele p-Value Track Accession
C 9.2e-9
IGAP 2013: Stages 1 and 2
NG00036

NHGRI GWAS Catalog: Alzheimer's Disease

Alzheimer's Disease-related annotations for the dbSNP refSNP associated with this variant in the NHGRI GWAS Catalog.

The following variants have been associated with AD-relevant neuropathologies in a GWAS study:

NIAGADS: Related neuropathologies and AD biomarkers

NIAGADS AD GWAS summary statistics datasets in which this variant has a genome-wide significance supported by a p-value ≤ 5 x 10-8.

For exome array studies, a cutoff of p-value < 1 x 10-3 was used.

Click on accession numbers to view a detailed report about the dataset or to request access to the data.

NHGRI: Other Traits (incl. related neuropathologies and AD biomarkers)

Trait associations for the dbSNP refSNP associated with this variant in the NHGRI GWAS Catalog.

Predicted Variant Effect

Back to Top

Combined Annotation Dependent Depletion (CADD) PHRED-normalized scores.

The higher the score, the more deleterious the substitution is predicted to be.

PHRED-normalized scores indicate ranked deleteriousness across ~8.6 billion SNVs on the human genome (GRCh37/hg19).

A normalized-score ≥10 indicates that the variant is predicted to be among the 10% most deleterious substitutions on the human genome.

A score ≥20 indicates that the variant is among the top 1% most deleterious.

The ranked deleteriousness of this variant (CADD PHRED-score) is: 0.362

This variant is colocated with 3 transcripts in 1 gene, with the following predicted effects:

All Predictd Effects (incl. intergenic)

Most Severe Predicted Effects

Back to Top

Group By: Analysis Consequence Impact Gene

Analysis Gene Ranked Over Consequence Impact
SnpEff AC011558.5 all transcripts upstream gene variant MODIFIER
SnpEff ABCA7 all transcripts intron variant MODIFIER
SnpEff CNN2 all transcripts downstream gene variant MODIFIER

Functional Genomics

Back to Top

Transcription Factor Occupancy (CATO)
contextual analysis of transcription factor occupancy (CATO) scores precomputed for dbSNP 142 in humans (hg19)

Transcription Factor Binding Site Overlap (ENCODE ChIP-SEQ)

DNase Hotspots Overlap (ENCODE DNase-SEQ)

Expressed Enhancer Overlap (FANTOM5)