The GenomicsDB is currently experiencing server issues. Searches and related features may not be available during this time. We apologize for the inconvenience.

SNP rs6656401

TTTCCTTCTCTGTCTCCATCTTCTC[G/A]TCGCCTTCTCCTCTGTGTGTGTCCT

Genomic Context

The genome browser snapshot is fully interactive. Mouse over track elements for more information. Click and drag to move tracks. Click and drag on top positional guide to zoom to a sub-region.

To add tracks, use the provided link to switch to the full genome browser view.

Variant Effect Impact (snpEff)

  • High
  • Moderate
  • Low
  • Modifier
  • Not Reported
  • Reference Allele: A
  • Minor Allele/Frequency: G/0.06669
  • Variant Class: single nucleotide variant
  • Closest Gene: CR1

Genome-wide significance

NIAGADS: Alzheimer's Disease

NIAGADS AD GWAS summary statistics datasets in which SNP rs6656401 has a genome-wide significance supported by a p-value ≤ 5 x 10-8.

For exome array studies, a cutoff of p-value < 1 x 10-3 was used.

See methods for more information.

Click on accession numbers to view a detailed report about the dataset or to request access to the data.

To view functional genomics annotations on the genome browser, first select tracks in the table below and then use the provided button to load the tracks on the browser.

p-Value Allele Track Accession Mapped From Get SNPs
5.75e-24 G
IGAP 2013: Stages 1 and 2
summary statistics for IGAP (2013): stages 1 and 2, combined
NG00036 N/A
7.76e-15 G
IGAP 2013: Stage 1
summary statistics for IGAP (2013): stage 1
NG00036 N/A
3.39e-10 A
ADGC 2011: Stages 1 and 2
summary statistics for ADGC (2011): stages 1 and 2, unadjusted
NG00027 N/A
1.91e-08 A
ADGC 2011: Stage 1
summary statistics for ADGC (2011): stage 1, unadjusted
NG00027 N/A
3.31e-08 A
ADGC 2011: Stages 1 and 2 Adjusted for Age, Sex and APOE
summary statistics for ADGC (2011): stages 1 and 2, adjusted for APOE, Age, and Sex
NG00027 N/A

NIAGADS: Related Neuropathologies

NHGRI: Alzheimer's Disease

Alzheimer's Disease-related annotations for this SNP in the NHGRI GWAS Catalog.

Disease or Trait p-Value Allele Variant Type Citation
Alzheimer's disease (late onset) 6.03e-24 A intron variant PMID: 24162737
Alzheimer's disease 3.02e-10 N/A intron variant PMID: 19734903

NHGRI: Other Traits

Predicted Effects