SNP rs557172708

TTTGTATTTTTAGTAGAGATGGGGT[A/T]TCACCATGTTGGCCAGGCTGGTCTC

Genomic Context

The genome browser snapshot is fully interactive. Mouse over track elements for more information. Click and drag to move tracks. Click and drag on top positional guide to zoom to a sub-region.

To add tracks, use the provided link to switch to the full genome browser view.

Variant Effect Impact (snpEff)

  • High
  • Moderate
  • Low
  • Modifier
  • Not Reported
  • Reference Allele: T
  • Minor Allele/Frequency: A/0.0007987
  • Variant Class: single nucleotide variant
  • Closest Gene: APOE

Genome-wide significance

NIAGADS: Alzheimer's Disease

NIAGADS: Related Neuropathologies

NHGRI: Alzheimer's Disease

NHGRI: Other Traits

Predicted Effects