SNP rs539159437

TATCCCTGGGGGAGGGGGCGGGACA[C/G]GGGGAGCCCTATAATTGGACAAGTC

Genomic Context

The genome browser snapshot is fully interactive. Mouse over track elements for more information. Click and drag to move tracks. Click and drag on top positional guide to zoom to a sub-region.

To add tracks, use the provided link to switch to the full genome browser view.

Variant Effect Impact (snpEff)

  • High
  • Moderate
  • Low
  • Modifier
  • Not Reported
  • Reference Allele: G
  • Minor Allele/Frequency: C/0.001398
  • Variant Class: single nucleotide variant
  • Closest Gene: APOE

Genome-wide significance

NIAGADS: Alzheimer's Disease

NIAGADS: Related Neuropathologies

NHGRI: Alzheimer's Disease

NHGRI: Other Traits

Predicted Effects

SNP effects and putative impacts predicted using snpEff version 4.2.

See documentation for more information.

Impact Variant Type Allele Sequence Change Amino Acid Change Gene Feature Type Feature Feature BioType
MODIFIER 5 prime UTR variant C c.-110G>C N/A APOE transcript ENST00000252486 protein coding