SNP rs157581

TCAACAAAGGGTTGAGTAACCATTT[C/T]CAGGTGAGCCTTCCTGGTGTCCTTA

Genomic Context

The genome browser snapshot is fully interactive. Mouse over track elements for more information. Click and drag to move tracks. Click and drag on top positional guide to zoom to a sub-region.

To add tracks, use the provided link to switch to the full genome browser view.

Variant Effect Impact (snpEff)

  • High
  • Moderate
  • Low
  • Modifier
  • Not Reported
  • Reference Allele: T
  • Minor Allele/Frequency: C/0.3063
  • Variant Class: single nucleotide variant
  • Closest Gene: TOMM40

Genome-wide significance

NIAGADS: Alzheimer's Disease

NIAGADS AD GWAS summary statistics datasets in which SNP rs157581 has a genome-wide significance supported by a p-value ≤ 5 x 10-8.

For exome array studies, a cutoff of p-value < 1 x 10-3 was used.

See methods for more information.

Click on accession numbers to view a detailed report about the dataset or to request access to the data.

To view functional genomics annotations on the genome browser, first select tracks in the table below and then use the provided button to load the tracks on the browser.

p-Value Allele Track Accession Mapped From Get SNPs
1e-469 T
IGAP 2013: Stage 1
summary statistics for IGAP (2013): stage 1
NG00036 N/A
4.57e-81 T
ADGC Age of Onset LOAD
GWAS summary statistics for age of onset in ADGC LOAD GWAS datasets, after adjustment for sex, APOE ε4 number, and population stratification.
NG00048 chr19:45395714
4.27e-56 T
Neuropathologic features of AD and related dementias (case/control)
GWAS summary statistics from a comparative study of neuropathological features of Alzheimer's disease and related dementias: general case/control analysis comparing individuals with dementia and AD neuropathologies (cases) to those without clinical dementia and none or minimal AD neuropathologic changes (controls); includes both primary (relaxed documentation) and conservative (strict documentation) datasets
NG00041 N/A
1.12e-14 T
ADGC African Americans (2013)
GWAS summary statistics from an ADGC study of African Americans and their genetic risk for LOAD (2013)
NG00039 chr19:45395714

NIAGADS: Related Neuropathologies

NIAGADS non-AD (related neuropathology) GWAS summary statistics datasets in which SNP rs157581 has a genome-wide significance supported by a p-value ≤ 5 x 10-8.

For exome array studies, a cutoff of p-value < 1 x 10-3 was used.

See methods for more information.

Click on accession numbers to view a detailed report about the dataset or to request access to the data.

To view functional genomics annotations on the genome browser, first select tracks in the table below and then use the provided button to load the tracks on the browser.

p-Value Allele Track Accession Mapped From Get SNPs
1.00e-55 T
Neuritic plaques (presence vs. absence); relaxed
GWAS summary statistics from a comparative study of neuropathological features of Alzheimer's disease and related dementias: NPs (presence versus absence), inclusive primary dataset allowing some incomplete documentation of pathological features
NG00041 N/A
8.32e-40 T
Neurofibrillary tangles (ranked by Braak stages)
GWAS summary statistics from a comparative study of neuropathological features of Alzheimer's disease and related dementias: NFTs (Braak stages)
NG00041 N/A
1.35e-39 T
Neuritic plaques (ranked by CERAD score)
GWAS summary statistics from a comparative study of neuropathological features of Alzheimer's disease and related dementias: NPs (CERAD score)
NG00041 N/A
3.47e-38 T
Neurofibrillary tangles (ranked by Braak groups)
GWAS summary statistics from a comparative study of neuropathological features of Alzheimer's disease and related dementias: NFTs (Braak groups)
NG00041 N/A
2.19e-35 T
Neuritic plaques (presence vs. absence); conservative
GWAS summary statistics from a comparative study of neuropathological features of Alzheimer's disease and related dementias: NPs (presence versus absence) restricted to cases and controls with complete documentation
NG00041 N/A
3.55e-23 T
Neuritic plaques (presence vs. absence)
GWAS summary statistics from a comparative study of neuropathological features of Alzheimer's disease and related dementias: NPs (presence vs. absence)
NG00041 N/A
8.71e-20 T
Cerebral amyloid angiopathy (presence vs. absence)
GWAS summary statistics from a comparative study of neuropathological features of Alzheimer's disease and related dementias: CAA (presence vs. absence)
NG00041 N/A
9.33e-09 T
Lewy body disease (5 category ranking)
GWAS summary statistics from a comparative study of neuropathological features of Alzheimer's disease and related dementias: LBD (none, brainstem-predominant, limbic, neocortical, and other regions or not specified)
NG00041 N/A
4.37e-08 T
Lewy body disease (3 category ranking)
GWAS summary statistics from a comparative study of neuropathological features of Alzheimer's disease and related dementias: LBD (none, brainstem-predominant, and all other regions or not specified)
NG00041 N/A

NHGRI: Alzheimer's Disease

NHGRI: Other Traits

Predicted Effects

SNP effects and putative impacts predicted using snpEff version 4.2.

See documentation for more information.

Impact Variant Type Allele Sequence Change Amino Acid Change Gene Feature Type Feature Feature BioType
LOW synonymous variant C c.339T>C p.Phe113Phe TOMM40 transcript ENST00000252487 protein coding
LOW synonymous variant C c.339T>C p.Phe113Phe TOMM40 transcript ENST00000405636 protein coding
LOW synonymous variant C c.339T>C p.Phe113Phe TOMM40 transcript ENST00000592434 protein coding
LOW synonymous variant C c.339T>C p.Phe113Phe TOMM40 transcript ENST00000426677 protein coding
LOW synonymous variant C c.339T>C p.Phe113Phe TOMM40 transcript ENST00000589649 protein coding