SNP rs12721051

CGAACTCCTGACCTCAAGTGATCAG[G/C]CTACCTCGGCCTCCCAAAGTGTTGG

Genomic Context

The genome browser snapshot is fully interactive. Mouse over track elements for more information. Click and drag to move tracks. Click and drag on top positional guide to zoom to a sub-region.

To add tracks, use the provided link to switch to the full genome browser view.

Variant Effect Impact (snpEff)

  • High
  • Moderate
  • Low
  • Modifier
  • Not Reported
  • Reference Allele: C
  • Minor Allele/Frequency: G/0.1136
  • Variant Class: single nucleotide variant
  • Closest Gene: APOC1

Genome-wide significance

NIAGADS: Alzheimer's Disease

NIAGADS AD GWAS summary statistics datasets in which SNP rs12721051 has a genome-wide significance supported by a p-value ≤ 5 x 10-8.

For exome array studies, a cutoff of p-value < 1 x 10-3 was used.

See methods for more information.

Click on accession numbers to view a detailed report about the dataset or to request access to the data.

To view functional genomics annotations on the genome browser, first select tracks in the table below and then use the provided button to load the tracks on the browser.

p-Value Allele Track Accession Mapped From Get SNPs
1e-482 C
IGAP 2013: Stage 1
summary statistics for IGAP (2013): stage 1
NG00036 N/A
5.01e-84 C
ADGC Age of Onset LOAD
GWAS summary statistics for age of onset in ADGC LOAD GWAS datasets, after adjustment for sex, APOE ε4 number, and population stratification.
NG00048 chr19:45422160
3.39e-15 C
ADGC African Americans (2013)
GWAS summary statistics from an ADGC study of African Americans and their genetic risk for LOAD (2013)
NG00039 chr19:45422160

NIAGADS: Related Neuropathologies

NHGRI: Alzheimer's Disease

NHGRI: Other Traits

Predicted Effects

SNP effects and putative impacts predicted using snpEff version 4.2.

See documentation for more information.

Impact Variant Type Allele Sequence Change Amino Acid Change Gene Feature Type Feature Feature BioType
LOW sequence feature G c.195-270C>G N/A APOC1 helix ENST00000588802 protein coding
MODIFIER 3 prime UTR variant G c.*5C>G N/A APOC1 transcript ENST00000590334 nonsense mediated decay